Homology and Analogy

The Loxodonta (African elephants) and Elephas (Asian elephants) both have a proboscis (an elongated appendage from their head – their trunk).  

The difference between the African and Asian Elephant trunks is that the African trunk has two ‘fingers’ at the snout while the Asian trunk only has one. This is most likely due to geographical differences.

Both species being a part of the Elephantidae family, they diverged from a common ancestor of the Mammutidae, which includes species termed as mastodons.

 African Elephant

Asian Elephant

 African Trunk

Asian Trunk

The Elephantidae and the Tapir both have a proboscis. A tapir is a large browsing mammal, similar to a pig’s shape, with short legs and a snout for grabbing or holding.

The tapir uses it’s just the same as an elephant. The tapir’s snout is highly flexible, able to move in all directions, and allows it to grab food that would otherwise be out of reach. The Elephants trunk is similarly famous for this. These two animals don’t seem to have a common ancestor as the elephants (proboscidea) and tapirs (perissodactyla) order seem too dissimilar.

Elephant

Tapir

Protein Synthesis - Decode DNA

TACCAACCGTTGAATACTGAAACCGGCATACGAGCTATGTCAATC

Influences on Darwin

Alfred Russel Wallace had the largest influence, in my opinion, on Darwin’s theory of natural selection. He provided positive support, for an otherwise unsure Darwin, for his theory through his paper ‘On the Tendency of Varieties to Depart Indefinitely from the Original Type,’ reinforcing Darwin’s already existing idea that all animals evolved through competition and survival of the fittest.

Wallace traveled extensively in his lifetime in Asia and South America. He simultaneously developed the same evolution ideas as Darwin, but independently. They corresponded and shared their ideas. Charles Lyell and Joseph Hooker then arranged for their theories to be presented at the Linnaean Society in 1858. Now maybe facing a credit dispute for his ideas, Darwin pushed to have his book he had been working on for 20 years published, ‘On the Origin of Species.’ Wallace continued to work in biogeography. http://evolution.berkeley.edu/evolibrary/article/history_14

Wallace had nearly the exact same ideas as Darwin. He contributed most to the point that ‘if the environment changes, the traits that are helpful or adaptive to that environment will be different.’ Although heredity was unknown until the 20^th century, Wallace and Darwin still accepted this notion due to variations in species, even though they didn’t know what those variations were. Again, after Darwin found out Wallace had this same idea - it furthered him to publish ‘On the Origin of Species.’

So, since Wallace and Darwin brought about their ideas separate from each other without ever corresponding, it could have been very possible that Darwin would have published his book anyway, although maybe it would have taken longer for someone to persuade him to.

Public opinion on the book was negative. However scholars praised, and scientists gradually took hold of it. Darwin lived in a time where the Bible should be read literally and any religious doubt was sinful. So he made sure he would denounce any objections before publishing, which again, took 20 years.